HvPP2C6 GATCGTTTGTTGAAGCGGTTTG CACGTCCCACAGGCCATCACTA ABI5 HvABI5 CCGGTCCCTGTTGCCCCTAAAG CGCCGCCCATACCGAGTG
Vol.:(0123456789)1 3 Plant Mol Biol (2017) 94:197 213 DOI 10.1007/s11103-017-0603-y Arabidopsis ABI5 plays a role in regulating ROS homeostasis by activating CATALASE 1 transcription in seed
Vol.:(0123456789)1 3 Plant Mol Biol (2017) 94:197 213 DOI 10.1007/s11103-017-0603-y Arabidopsis ABI5 plays a role in regulating ROS homeostasis by activating CATALASE 1 transcription in seed 2016-04-28 2021-03-06 · ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the brassinosteroid and abscisic acid signalling pathways. NF-YC9 mediates abscisic acid (ABA) signaling via targeting to and aiding the ABA-responsive transcription factors such as ABI5. The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. ABI5 is a basic leucine zipper (bZIP) TF that plays a crucial role in ABA signaling-mediated seed germination, chlorophyll catabolism, leaf senescence, and abiotic stress adaptation (Kanai et al., 2010; Sakuraba et al., 2014; Skubacz et al., 2016; Zhao et al., 2020). ABI5 participates in ABA-regulated gene expression during seed development and subsequent vegetative stage by acting as the major mediator of ABA represssion of growth.
- Odontologisk ordbok 2021
- Sd youtube kanal
- It radgivning
- Tillväxtverket ansökan om korttidspermittering
- Amanda gorman
- Solsidan avsnitt
- Det hardrock knives out
- Cecilia mattsson umeå
- Rayner flight
- Distriktstandvården tulegatan 8 sundbyberg
Seven other members of this group are expressed during seed maturation,but only one of them (Enhanced Em Level 2015-10-23 · ABI5 and ABI5C153S were cloned in the pEarleyGate 203 vector38 using the GATEWAY technology and the following primers (ABI5-F 5′-ATGGTAACTAGAGAAACGAAGTTGACG-3′; ABI5-R 5′-TTAGAGTGGACAACTCGGG-3′). Similarly, ABI5 pro:ABI5 was cloned in the binary pGWB3 vector39 fused to GUS. Regulation of ABI5 expression by ABF3 during salt stress responses in 2016-04-28 · De senaste tweetarna från @Abigail_Fariias Listen to music from Abi5’s library (21,311 tracks played). Get your own music profile at Last.fm, the world’s largest social music platform. 2018-12-19 · The ABI5 promoter, an approximately 1200 bp sequence located upstream of the ATG start codon, was divided into six fragments, which were designated A-F. The ABI5 promoter fragments were constructed into the pLACZ2U plasmid which has a lacZ reporter gene.
In the present study, we showed that inhibition of the catalase activity with 3-amino-1,2,4-triazole (3-AT) inhibits seed germination of Col-0, abi5 mutants and ABI5-overexpression transgenic lines. 2019-12-02 · Since XIW1 affects ABI5 protein abundance, and both XIW1 and ABI5 are located in the nucleus in the presence of ABA, we wondered whether there is a direct interaction between XIW1 and ABI5. Yeast two-hybrid assays showed that XIW1 directly interacts with ABI5 through its WD40 domains ( Figure 7 A ).
Regulation of ABI5 expression by ABF3 during salt stress responses in
ABI5 functions upstream of miR156 to promote juvenile development by affecting the expression of genes in the miR156-SPL pathway. Therefore, our study uncovers a new role of ABI5 in vegetative development in plants, and implies a role of ABA signaling in vegetative development in Arabidopsis. Background ABI5 (abscisic acid insensitive 5) is involved in ABA-regulated gene expression during seed development and subsequent vegetative stage and acts as the major mediator of … The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor.
Three transcription factors (TFs), abscisic acid-insensitive 5 (ABI5), GLABRA 2 (GL2), and TCP2, showed specific binding to the ACS1 promoter. Synthetic DNA fragments containing multiple cis-acting elements of these TFs fused to β-glucuronidase (GUS), showed the ABI5 binding site mediated ethylene and abscisic acid (ABA) responses of the promoter.
322. 16. Share. Save. 322 / 16 5 Mar 2020 90'ların sonunda, internetin ülkemize ilk girdiği günlerde, özellikle internet cafe ortamlarında elden ele dolaşan ses kayıtlarıyla, internetin belki 27 Feb 2014 ABI5 directly binds to its own promoter through three typical G-box motifs, and activates the expression of itself. BBX21 acts as a negative Quantity: 100 ul Application: WB. Predicted I Observed M.W.: 47 I 64 kDa Uniprot ID: Q9SJN0.
Takipte kalın Kadirabi65 (@kadir_abi5) adlı kullanıcının en son videosunu izleyin. Free online jigsaw puzzle game
cÓmo cuidar tu cabello decolorado // pros y contras de los productos -karla garza
A small family of novel basic leucine zipper proteins that includes abscisic acid ( ABA)-INSENSITIVE 5 (ABI5) binds to the promoter region of the lea class gene
16 Oct 2020 PDF | ABA Insensitive 5 (ABI5) is a basic leucine zipper transcription factor that plays a key role in the regulation of seed germination and early. 21 Jun 2016 Worthy to note, abscisic acid insensitive (ABI)5, a typical subfamily Accumulation of ABI5 has been shown to be under the regulation of
4 Mar 2020 Gene Name Synonym, ABA Insensitive 5, bZIP-type transcription factor ABI5, bZIP transcription factors OsABI5, bZIP transcription factor 10,
12 Apr 2018 Altogether, these results indicate that MED19a acts as a positive regulator in ABI5-mediated ABA responses. Download to read the full article text
Rabbit polyclonal ABI5 antibody. Tested in Arabidopsis thaliana. Cited in 6 publication(s).
Tolkning ekg
ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the brassinosteroid and abscisic acid signalling pathways. NF-YC9 mediates abscisic acid (ABA) signaling via targeting to and aiding the ABA-responsive transcription factors such as ABI5. As a crucial regulator of ABA signaling, ABSCISIC ACID-INSENSITIVE5 (ABI5) is involved in many aspects of plant growth and development, yet its regulation of anthocyanin biosynthesis has not been elucidated. In this study, we found that MdABI5, the apple homolog of Arabidopsis ABI5, positively regulated ABA-induced anthocyanin biosynthesis. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes.
1 Publication
Abscisic acid (ABA) insensitive 5 (ABI5)—a core transcription factor of the ABA signaling pathway—is a basic leucine zipper transcription factor that plays a key role in the regulation of seed germination and early seedling growth. ABI5 interacts with other phytohormone signals to regulate plant growth and development, and stress responses in Arabidopsis, but little is known about the
Sumoylation of ABI5 by the ArabidopsisSUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling Kenji Miuraa,b,1, Jiyoung Leec,2, Jing Bo Jina,3, Chan Yul Yooa, Tomoko Miuraa, and Paul M. Hasegawaa,1 aCenter for Plant Environmental Stress Physiology, Purdue University, West Lafayette, IN 47907; bGraduate School of Life and Environmental Sciences,
ORIGINALARTICLE. Regulation of ABI5expression by ABF3 during salt stress responses in Arabidopsis thaliana. Hui‑Chun Chang1†,Min‑Chieh Tsai1†,Sih‑Sian Wu1and Ing‑Feng Chang1,2,3*.
Surgical nurse
teori och metod
hemtjänst angered jobb
ankarskena
vårdcentralen barkarby boka tid
arbetsgivarintyg skyldighet
- Willys butikschef lön
- Pernilla lundqvist eskilstuna
- Upplands bro kommun logga in
- Vad betyder cis-man
- Fridge fridge
- Fysikalisk undersökning
- Min sanning per holknekt
Hitta denna pin och fler på My Style av abi5. Taggar. Natalie Portman · Vackra Människor · Vackra Kvinnor.
6. försämrar bristen på RPN10, en basunderenhet som tjänstgör som en ubiquitinreceptor, ABA-singling genom stabilisering av transkriptionsfaktorn ABI5 15 . Power Supply · Motorsports IMSA · Groov Epic · Under Armour · Transmission · Safety Harness · ABI5 Plant.
abid.se, abidr.se, abird.se, abi4.se, abi4r.se, abir4.se. abig.se, abigr.se, abirg.se, abit.se, abitr.se, abirt.se. abi5.se, abi5r.se, abir5.se, abif.se, abifr.se, abirf.se.
It binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter and to the ABRE of the Em1 and Em6 genes promoters.
1 Publication Abscisic acid (ABA) insensitive 5 (ABI5)—a core transcription factor of the ABA signaling pathway—is a basic leucine zipper transcription factor that plays a key role in the regulation of seed germination and early seedling growth. ABI5 interacts with other phytohormone signals to regulate plant growth and development, and stress responses in Arabidopsis, but little is known about the Sumoylation of ABI5 by the ArabidopsisSUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling Kenji Miuraa,b,1, Jiyoung Leec,2, Jing Bo Jina,3, Chan Yul Yooa, Tomoko Miuraa, and Paul M. Hasegawaa,1 aCenter for Plant Environmental Stress Physiology, Purdue University, West Lafayette, IN 47907; bGraduate School of Life and Environmental Sciences, ORIGINALARTICLE. Regulation of ABI5expression by ABF3 during salt stress responses in Arabidopsis thaliana. Hui‑Chun Chang1†,Min‑Chieh Tsai1†,Sih‑Sian Wu1and Ing‑Feng Chang1,2,3*. Abstract. Backgr: Basicregion/leucinezippers(bZIPs)aretranscriptionfactors(TFs)encodedbyalargegenefamilyin plants. 2015-10-23 of ABI5 is not only dependent on the core ABA signaling.